SitemapContact Us
닫기
Search
Advanced Search +
닫기
Quick links
Most Cited Most Read Ahead of Print Archives Go to E-submission

Original Article

Split Viewer

Blood Res 2021; 56(3):

Published online September 30, 2021

https://doi.org/10.5045/br.2021.2020335

© The Korean Society of Hematology

The expression of multiple cancer/testis antigens can potentially be used to detect circulating disease and clonal evolution in the peripheral blood of multiple myeloma patients

Karen Shires1, Teagan Van Wyk2, Kirsty Wienand3

Author Info. +

1Division of Haematology, Department of Pathology, University of Cape Town and National Health Laboratory Service/Groote Schuur Hospital, 2Department of Medicine, University of Cape Town, Cape Town, South Africa, 3Division of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA

Correspondence to : Karen Shires, Ph.D.
Division of Haematology, UCT Medical School, Anzio Road, Observatory 7221, Cape Town, South Africa
E-mail: Karen.shires@uct.ac.za

Revised: June 16, 2021; Accepted: July 8, 2021

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Go to

Background
It is thought that cancer/testis antigens (CTAs) are expressed in a cascade-like manner in multiple myeloma as the disease progresses. In this pilot study, we investigated the co-expression of several CTAs in the peripheral blood (PB) during patient therapy to establish whether monitoring multiple CTAs allows for the prediction of relapse and clonal evolution.
Methods
We examined the co-expression of MAGEC1, MAGEA3, PRAME, and BAGE2 via quantitative reverse transcription-polymerase chain reaction (qRT-PCR) duplex assays in the PB mononuclear cells of 10 patients on chemotherapy at 3-month intervals, and correlated the levels to those of two basic clinical monitoring markers, serum -2-microglobulin and serum M protein. Clonal evolution was investigated using flow cytometry to label the circulating malignant stem cell components with MAGEC1, PRAME, and MAGEA3 antibodies.
Results
Simultaneous monitoring of MAGEC1/PRAME provided sensitive detection of circulating malignant cells in easily accessible PB samples; transcript levels increased prior to changes in indicators of clinical relapse. While MAGEA3/BAGE2 expression levels did not offer earlier prediction of relapse, they provided insight into significant changes occurring within the malignant cell population; the addition of either CTA to a MAGEC1-monitoring panel allowed for better classification of the relapse event (clonal evolution), which in turn could potentially guide treatment strategies in the future.
Conclusion
This pilot study supports the novel idea of determining the levels and CTA expression patterns of the total circulating malignant cell population (pro-B/pre-B stem cell progenitors and proliferating plasma cells) as an alternate disease monitoring methodology.

Keywords CTA, MAGEC1, Myeloma, Cascade, Monitoring, PRAME

Article

Original Article

Blood Res 2021; 56(3): 156-165

Published online September 30, 2021 https://doi.org/10.5045/br.2021.2020335

Copyright © The Korean Society of Hematology.

The expression of multiple cancer/testis antigens can potentially be used to detect circulating disease and clonal evolution in the peripheral blood of multiple myeloma patients

Karen Shires1, Teagan Van Wyk2, Kirsty Wienand3

1Division of Haematology, Department of Pathology, University of Cape Town and National Health Laboratory Service/Groote Schuur Hospital, 2Department of Medicine, University of Cape Town, Cape Town, South Africa, 3Division of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA

Correspondence to:Karen Shires, Ph.D.
Division of Haematology, UCT Medical School, Anzio Road, Observatory 7221, Cape Town, South Africa
E-mail: Karen.shires@uct.ac.za

Revised: June 16, 2021; Accepted: July 8, 2021

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background
It is thought that cancer/testis antigens (CTAs) are expressed in a cascade-like manner in multiple myeloma as the disease progresses. In this pilot study, we investigated the co-expression of several CTAs in the peripheral blood (PB) during patient therapy to establish whether monitoring multiple CTAs allows for the prediction of relapse and clonal evolution.
Methods
We examined the co-expression of MAGEC1, MAGEA3, PRAME, and BAGE2 via quantitative reverse transcription-polymerase chain reaction (qRT-PCR) duplex assays in the PB mononuclear cells of 10 patients on chemotherapy at 3-month intervals, and correlated the levels to those of two basic clinical monitoring markers, serum -2-microglobulin and serum M protein. Clonal evolution was investigated using flow cytometry to label the circulating malignant stem cell components with MAGEC1, PRAME, and MAGEA3 antibodies.
Results
Simultaneous monitoring of MAGEC1/PRAME provided sensitive detection of circulating malignant cells in easily accessible PB samples; transcript levels increased prior to changes in indicators of clinical relapse. While MAGEA3/BAGE2 expression levels did not offer earlier prediction of relapse, they provided insight into significant changes occurring within the malignant cell population; the addition of either CTA to a MAGEC1-monitoring panel allowed for better classification of the relapse event (clonal evolution), which in turn could potentially guide treatment strategies in the future.
Conclusion
This pilot study supports the novel idea of determining the levels and CTA expression patterns of the total circulating malignant cell population (pro-B/pre-B stem cell progenitors and proliferating plasma cells) as an alternate disease monitoring methodology.

Keywords: CTA, MAGEC1, Myeloma, Cascade, Monitoring, PRAME

Fig 1.

Download
Figure 1.PRAME transcript expression in MM patients during chemotherapy.
RNA samples collected from patients MM1, 4, and 6 at diagnosis and during treatment were analyzed for PRAME expression using the PRAME/ABL qRT-PCR assay. The normalized ratios were plotted along with the previously collected normalized MAGEC1 data [21] and serum M and Sb2M levels. *Indicates patient death within three months of the last data point; C+D, cyclophosphamide/dexamethasone cycles; M+P, melphalan/prednisone cycles; R, localiszd radiation; open circles indicate a lack of detectable transcripts at a sensitivity level determined by the corresponding ABL Cq.
Blood Research 2021; 56: 156-165https://doi.org/10.5045/br.2021.2020335

Fig 2.

Download
Figure 2.MAGEA3 transcript expression in MM patients during chemotherapy.
RNA samples collected from patients MM 3, 8, and 10 at diagnosis and during treatment were analyzed for MAGEA3 expression using the MAGEA3/ABL qRT-PCR assay. The normalized ratios were plotted along with the previously collected normalized PRAME data, MAGEC1 data [21], and serum M levels. *Indicates patient death within three months of the last data point; C+D, cyclophosphamide/dexamethasone cycles; R, localized radiation. Open circles indicate a lack of detectable transcripts.
Blood Research 2021; 56: 156-165https://doi.org/10.5045/br.2021.2020335

Fig 3.

Download
Figure 3.BAGE2 transcript expression in MM patients during chemotherapy.
RNA samples collected from patients MM 6, 8, and 9 at diagnosis and during treatment were analyzed for BAGE2 expression using the BAGE2/ABL qRT-PCR assay. The normalized ratios were plotted along with the previously collected normalized MAGEA3, PRAME, and MAGEC1 data and serum M/Sβ2M levels. *Indicates patient death within three months of the last data point; colored arrows indicate the date of associated transcript increase, showing a succession pattern; Crt, creatinine mmol/l; Hb, hemoglobin g/dL; open circles indicate a lack of detectable transcript.
Blood Research 2021; 56: 156-165https://doi.org/10.5045/br.2021.2020335

Fig 4.

Download
Figure 4.Schematic of the proposed evolution of MM clones based on the expression of a CTA cascade.
Blood Research 2021; 56: 156-165https://doi.org/10.5045/br.2021.2020335

Table 1 . Diagnostic characteristics of multiple myeloma (MM) patients (modified from Shires and Wienand, 2016 [21])..

Patient No.Age, sexDisease subtype (Igk/Igl)a)Disease stage at diagnosisb), CRAB featuresc)TreatmentSampling period (mo)% MAGEC1 cells at diagnosis in PB
Totale)CD34+CD19+CD138+f)
166, FIgGl2, RABCyclophosphamide+dexamethasone, localized radiation12d)1.290.710.460.12
280, MIgAl3, CRABAlternating between cyclophosphamide+dexamethasone and melphalan+prednisone9d)1.350.430.520.41
373, FIgGl1, ABCyclophosphamide for one month, thereafter no myeloma treatment241.820.860.860.22
473, FIgGk1, BMelphalan+prednisone241.991.000.930.06
633, MIgGk2, ABAlternating between cyclophosphamide+dexamethasone and melphalan+prednisone18d)1.150.590.430.13
766, MIgGk2, ABAlternating between cyclophosphamide+prednisone and melphalan+prednisone, localized radiation241.240.410.450.29
849, FIgAk3, RABCyclophosphamide+dexamethasone as well as localized radiation12d)1.460.420.750.26
983, FIgGk1, ABCyclophosphamide+prednisone as well as localized radiation241.120.450.420.26
1064, MIgAk2, ABCyclophosphamide+dexamethasone6d)1.150.650.460.05
1266, MIgGk2, RBLocalized radiation, cyclophosphamide+prednisone6d)1.170.220.650.25

a)Immunoglobulin G or A Lambda (Igl)/Kappa (Igk). b)ISS–International staging system (Greipp et al. 2005 [30]). c)Calcium >2.75 mmol/L; Renal: creatinine >90 mmol/L (F), >110 mmol/L (M); Anaemia: HB <12 g/dL (F), <13 g/dL (M); Bone lesions. d)Sampling period <24 months due to patient death. e)Calculated as the % of specific cells present in the mononuclear Ficoll preparation using flow cytometry, as previously described [21]. f)All MAGEC1-positive PC cells co-expressed ki-67, indicating proliferation potential [21]..

Abbreviations: F, female; M, male..

Table 2 . Primers and probe sequences for the CTA duplex qRT-PCR assays..

MAGEA3/ABL duplex (NM_5362.3)a)
CTA primersTCTTGAGCAGAGGAGTCAGCAC (F); GATCTGGTGACTCGGGAGCA (R)
CTA probe56-FAM/CTCCCCCAG/ZEN/GGTGACTTCAACTA/3IABkFQ
ABL primersTGGAGATAACACTCTAAGCATAACTAA (F)
GATGTAGTTGCTTGGGACCCA (R)
ABL probeCy5/CCATTTTTGGTTTGGGCTTCACACCATT/IAbRGSp
Amplicon176 bp (MAGEA3)+124 bp (ABL)
PRAME/ABL duplex (NM_6115.4)
CTA primersCTGTGCTTGATGGACTTGATGTG (F)
GCTGCTCTGCCTCTGTGCTC (R)
CTA probe56-FAM/ACCATCTAC/ZEN/TTTTCGCTTCTTTGTCATGGG/3IABkFQ
ABL primersTGGAGATAACACTCTAAGCATAACTAA (F)
GATGTAGTTGCTTGGGACCCA (R)
ABL probeCy5/CCATTTTTGGTTTGGGCTTCACACCATT/IAbRGSp
Amplicon216 bp (PRAME)+124 bp (ABL)
BAGE2/ABL duplex (NM_1839676.1)
CTA primersCGGCCAGAGCGGTTTTT (F)
CTCCTCCTATTGCTCCTGTTG (R)
CTA probe56-FAM/CGTCTCCAT/ZEN/CACCGTGGCTGCCACAA/IABkFG
ABL primersTGGAGATAACACTCTAAGCATAACTAA (F)
GATGTAGTTGCTTGGGACCCA (R)
ABL probeCy5/CCATTTTTGGTTTGGGCTTCACACCATT/IAbRGSp
Amplicon150 bp (BAGE2)+124 bp (ABL)

a)GenBank ref sequence ID for CTA gene..
Blood Res
Volume 59 2024
Current Issue Archives

Stats or Metrics

Share this article on

  • line

Related articles in BR

Blood Research

pISSN 2287-979X
eISSN 2288-0011
qr-code Download