Blood Res 2020; 55(2):
Published online June 30, 2020
https://doi.org/10.5045/br.2020.2020042
© The Korean Society of Hematology
Correspondence to : Oytip Nathalang, Ph.D.
Graduate Program in Biomedical Sciences, Faculty of Allied Health Sciences, Thammasat University, Pathumtani 12120, Thailand
E-mail: oytipntl@hotmail.com
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Background
SERF(+) is a high prevalence antigen in the Cromer blood group system that is encoded by a CROM*01.12 allele. The SERF(-) on red cells is caused by a single nucleotide variation, c.647C>T, in exon 5 of the Decay-accelerating factor, DAF gene. Alloanti-SERF was found in a pregnant Thai woman, and a SERF(-) individual was found among Thai blood donors. Since anti-SERF is commercially unavailable, this study aimed to develop appropriate genotyping methods for CROM*01.12 and CROM*01.-12 alleles and predict the SERF(-) phenotype in Thai blood donors.
Methods
DNA samples obtained from 1,580 central, 300 northern, and 427 southern Thai blood donors were genotyped for CROM*01.12 and CROM*01.-12 allele detection using in-house PCR with sequence-specific primer (PCR-SSP) confirmed by DNA sequencing.
Results
Validity of the PCR-SSP genotyping results agreed with DNA sequencing; CROM*01.12/ CROM*01.12 was the most common (98.42%, 98.00%, and 98.59%), followed by CROM*01.12/CROM*01.-12 (1.58%, 2.00%, and 1.41%) among central, northern, and southern Thais, respectively. CROM*01.-12/CROM*01.-12 was not detected in all three populations. The alleles found in central Thais did not significantly differ from those found in northern and southern Thais.
Conclusion
This study is the first to distinguish the predicted SERF phenotypes from genotyping results obtained using in-house PCR-SSP, confirming that the CROM*01.-12 allele frequency ranged from 0.007 to 0.010 in three Thai populations. This helps identify the SERF(-) phenotype among donors and patients, ultimately preventing adverse transfusion reactions.
Keywords Cromer blood group system, SERF negative phenotype, Genotyping, Thais
Cromer (CROM) blood group system antigens are carried on the decay-accelerating factor (DAF; CD55). Twenty antigens are currently assigned to this system by the International Society of Blood Transfusion (ISBT) Working Party on Red Cell Immunogenetics and Blood Group Nomenclature [1]. SERF is a high prevalence antigen first discovered in 2004 after the identification of alloanti-SERF in a pregnant SERF-negative, SERF(-), Thai woman. This antibody reacts with reagent red cells only during the indirect antiglobulin phase, and it is nonreactive with a-chymotrypsin-treated red cells [2, 3]. The genetic basis of the SERF antigen has already been determined. This antigen is encoded by the
In Thailand, the National Blood Centre of the Thai Red Cross Society revealed that 24.6% out of 2,821 patients who underwent an antibody identification test received a result called unidentified specificity, which arises due to a low-titer antibody in the work-up or due to the lack of extra cells with rare phenotypes [5]. The initial screening for Jk(a-b-), a rare phenotype, uses the urea lysis test, and confirmation through testing with anti-Jka and -Jkb is a cost-effective method [6]. In the Augustine blood group system, the PCR-sequence-specific primer (PCR-SSP) could differentiate between At(a+) and At(a-) when identifying the At(a-) phenotype despite the limited availability of antiserum. At(a-) is a rare phenotype restricted among Africans [7].
After more than a decade, only one case of the SERF(-) phenotype was reported in a related study involving the Thai population [4]. Blood transfusions are required to find a patient with an unidentified antibody specificity who is a suspected anti-SERF case. All stakeholders in blood transfusion services face a considerable challenge in finding compatible and safe transfusions for alloimmunized patients. This study aimed to develop appropriate genotyping methods for the
EDTA-anticoagulated peripheral venous blood samples were collected from 2,307 unrelated healthy blood donors. Overall, 1,580, 300, and 427 samples were obtained from donors who came from central, northern, and southern Thailand, respectively. Genomic DNA was extracted from all samples using a Genomic DNA extraction kit (REAL Genomics, RBCBioscience, Taipei, Taiwan) and stored at -20°C until used for genotyping. Informed consent was obtained from each subject. This study was approved by the Committee on Human Rights Related to Research Involving Human Subjects of the Thammasat University, Pathumtani, Thailand (COE No. 034/2561).
200 genomic DNA blood samples were sequenced to identify the
Table 1 Primer sequences for
Allele detected | Primer | Primer sequence (5’3’) | Product size (bp) |
---|---|---|---|
SERF_C+_F | TCTGTCCAGTGGAGTGACCC | 235 | |
SERF_R | AACTTGCTGGTTTATCTTCACAGC | ||
SERF_T-_F | TCTGTCCAGTGGAGTGACCT | 235 | |
SERF_R | AACTTGCTGGTTTATCTTCACAGC | ||
HGH-F | TGCCTTCCCAACCATTCCCTTA | 434 | |
HGH-R | CCACTCACGGATTTCTGTTGTGTTTC | ||
SEQ_SERF_600_F | CTTTCTAACATATTCCCCATGCAAA | 600 | |
SEQ_SERF_600_R | TGACCAAGTGCAATACAAACCT |
PCR was performed under the following conditions. Initial denaturation was conducted at 98°C for 30 s. The PCR program began with 10 cycles of 10 s at 98°C and 60 s at 69°C followed by 20 cycles of 30 s at 98°C, 60 s at 62°C, and 30 s at 72°C. The last step was a final extension for 5 min at 72°C. The PCR products were electrophoresed at 100 volts on a 1.5% agarose gel containing 10,000X fluorescent DNA gel stain (SYBR Safe DNA Gel Stain, Invitrogen, Paisley, UK) in 1X TBE buffer. The products were visualized using a blue light transilluminator. The PCR products were subsequently purified using a gel extraction kit (GeneJET Gel Extraction Kit, Thermo Scientific, MA, USA), and the eluted fragments were sequenced (U2Bio Sequencing Service, Bangkok, Thailand) using the abovementioned PCR primers.
The
PCR was performed under the following conditions. Initial denaturation was conducted at 95°C for 30 s. The PCR program began with 10 cycles of 30 s at 95°C and 60 s at 69°C followed by 20 cycles of 10 s at 95°C, 50 s at 60°C, and 30 s at 72°C. The last step was the final extension of 5 min at 72°C before keeping the sample at 4°C. The PCR products were electrophoresed at 100 volts on a 1.5% agarose gel in 1X TBE buffer. The gel was stained with SYBR Safe Stain and visualized using a blue light transilluminator. The size of the
The known DNA controls for the
The gene and allele frequencies in the Thai blood donors were estimated using gene counting. The allele frequencies in central Thais were compared to northern and southern Thais using the Pearson’s chi-square (χ2) test. All statistical analyses were conducted using SPSS Version 16.0 (SPSS Inc., Chicago, IL, USA). A
In addition, the probability of finding one donor with a predicted SERF(-) phenotype was estimated. According to the Hardy-Weinberg Equilibrium (HWE) equation, p2+ 2pq+q2=1, where p denotes the dominant allele frequency (
The number of testing units is 1/q2.
The DNA sequencing results showed that four of the 200 Thai blood donors were heterozygous for
Total of 1,580, 300, and 427 samples were obtained from the central, northern, and southern Thai blood donors, respectively. They were genotyped for
Table 2
Allele | Allele frequencies | Genotype | Observed (%) | χ2 (DF=1) | |
---|---|---|---|---|---|
Central Thais (N=1,580) | |||||
3,135 (0.992) | 1,555 (98.42) | NA | NA | ||
25 (0.008) | 25 (1.58) | ||||
0 (0.00) | |||||
Northern Thais (N=300) | |||||
594 (0.990) | 294 (98.00) | 0.269 | 0.604 | ||
6 (0.010) | 6 (2.00) | ||||
0 (0.00) | |||||
Southern Thais (N=427) | |||||
848 (0.993) | 421 (98.59) | 0.069 | 0.793 | ||
6 (0.007) | 6 (1.41) | ||||
0 (0.00) |
Abbreviations: DF, degree of freedom; NA, not applicable.
According to the HWE equation, homozygous recessive individuals (
Serological methods cannot always determine rare blood phenotypes owing to the limited availability of antiserum and of unmarketed products. To date, various molecular methods for red cell genotyping can be performed in blood bank laboratories to massively screen blood donors and to distinguish antibody specificity in recently transfused patients [9-13]. Given its reliability and simplicity, PCR-SSP is widely used in genotyping SNVs, especially in laboratories with limited resources [7, 14]. In Thailand, commercial kit-based red cell genotyping involving the use of PCR-sequence-specific oligonucleotide probes like Jk(a-b-), Fy(a-b+), and Di(a+b-) is employed only in specialized reference laboratories given its high cost and the need for complex equipment. However, mass screening with the aim to identify donors carrying rare phenotypes recognizes the phenotype frequency and the phenotype’s clinical significance in hemolytic transfusion reactions and in hemolytic disease of the fetus and newborn (HDFN). Only one case of alloanti-SERF was found (a pregnant Thai woman), and the occurrence of HDFN is unlikely because the DAF on the apical surface of trophoblasts in placenta absorbs maternal antibodies [15].
Concerning the predicament in finding SERF(-) blood donors and the shortage of data in Thai populations, this study has established that PCR-SSP could determine the
The frequencies of the
In conclusion, this study was the first to distinguish the predicted SERF phenotypes from the genotyping results obtained using the in-house PCR-SSP. Moreover, the results showed that the frequency of the
Blood Res 2020; 55(2): 107-111
Published online June 30, 2020 https://doi.org/10.5045/br.2020.2020042
Copyright © The Korean Society of Hematology.
Oytip Nathalang1, Kamphon Intharanut1, Nipapan Leetrakool2, Supattra Mitundee3, Pawinee Kupatawintu4
1Graduate Program in Biomedical Sciences, Faculty of Allied Health Sciences, Thammasat University, Pathumtani, 2Blood Bank Section, Faculty of Medicine, Chiang Mai University, Chiang Mai, 3Regional Blood Centre 12th Songkhla, Thai Red Cross Society, Songkhla, 4National Blood Centre, Thai Red Cross Society, Bangkok, Thailand
Correspondence to:Oytip Nathalang, Ph.D.
Graduate Program in Biomedical Sciences, Faculty of Allied Health Sciences, Thammasat University, Pathumtani 12120, Thailand
E-mail: oytipntl@hotmail.com
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Background
SERF(+) is a high prevalence antigen in the Cromer blood group system that is encoded by a CROM*01.12 allele. The SERF(-) on red cells is caused by a single nucleotide variation, c.647C>T, in exon 5 of the Decay-accelerating factor, DAF gene. Alloanti-SERF was found in a pregnant Thai woman, and a SERF(-) individual was found among Thai blood donors. Since anti-SERF is commercially unavailable, this study aimed to develop appropriate genotyping methods for CROM*01.12 and CROM*01.-12 alleles and predict the SERF(-) phenotype in Thai blood donors.
Methods
DNA samples obtained from 1,580 central, 300 northern, and 427 southern Thai blood donors were genotyped for CROM*01.12 and CROM*01.-12 allele detection using in-house PCR with sequence-specific primer (PCR-SSP) confirmed by DNA sequencing.
Results
Validity of the PCR-SSP genotyping results agreed with DNA sequencing; CROM*01.12/ CROM*01.12 was the most common (98.42%, 98.00%, and 98.59%), followed by CROM*01.12/CROM*01.-12 (1.58%, 2.00%, and 1.41%) among central, northern, and southern Thais, respectively. CROM*01.-12/CROM*01.-12 was not detected in all three populations. The alleles found in central Thais did not significantly differ from those found in northern and southern Thais.
Conclusion
This study is the first to distinguish the predicted SERF phenotypes from genotyping results obtained using in-house PCR-SSP, confirming that the CROM*01.-12 allele frequency ranged from 0.007 to 0.010 in three Thai populations. This helps identify the SERF(-) phenotype among donors and patients, ultimately preventing adverse transfusion reactions.
Keywords: Cromer blood group system, SERF negative phenotype, Genotyping, Thais
Cromer (CROM) blood group system antigens are carried on the decay-accelerating factor (DAF; CD55). Twenty antigens are currently assigned to this system by the International Society of Blood Transfusion (ISBT) Working Party on Red Cell Immunogenetics and Blood Group Nomenclature [1]. SERF is a high prevalence antigen first discovered in 2004 after the identification of alloanti-SERF in a pregnant SERF-negative, SERF(-), Thai woman. This antibody reacts with reagent red cells only during the indirect antiglobulin phase, and it is nonreactive with a-chymotrypsin-treated red cells [2, 3]. The genetic basis of the SERF antigen has already been determined. This antigen is encoded by the
In Thailand, the National Blood Centre of the Thai Red Cross Society revealed that 24.6% out of 2,821 patients who underwent an antibody identification test received a result called unidentified specificity, which arises due to a low-titer antibody in the work-up or due to the lack of extra cells with rare phenotypes [5]. The initial screening for Jk(a-b-), a rare phenotype, uses the urea lysis test, and confirmation through testing with anti-Jka and -Jkb is a cost-effective method [6]. In the Augustine blood group system, the PCR-sequence-specific primer (PCR-SSP) could differentiate between At(a+) and At(a-) when identifying the At(a-) phenotype despite the limited availability of antiserum. At(a-) is a rare phenotype restricted among Africans [7].
After more than a decade, only one case of the SERF(-) phenotype was reported in a related study involving the Thai population [4]. Blood transfusions are required to find a patient with an unidentified antibody specificity who is a suspected anti-SERF case. All stakeholders in blood transfusion services face a considerable challenge in finding compatible and safe transfusions for alloimmunized patients. This study aimed to develop appropriate genotyping methods for the
EDTA-anticoagulated peripheral venous blood samples were collected from 2,307 unrelated healthy blood donors. Overall, 1,580, 300, and 427 samples were obtained from donors who came from central, northern, and southern Thailand, respectively. Genomic DNA was extracted from all samples using a Genomic DNA extraction kit (REAL Genomics, RBCBioscience, Taipei, Taiwan) and stored at -20°C until used for genotyping. Informed consent was obtained from each subject. This study was approved by the Committee on Human Rights Related to Research Involving Human Subjects of the Thammasat University, Pathumtani, Thailand (COE No. 034/2561).
200 genomic DNA blood samples were sequenced to identify the
Table 1 . Primer sequences for
Allele detected | Primer | Primer sequence (5’3’) | Product size (bp) |
---|---|---|---|
SERF_C+_F | TCTGTCCAGTGGAGTGACCC | 235 | |
SERF_R | AACTTGCTGGTTTATCTTCACAGC | ||
SERF_T-_F | TCTGTCCAGTGGAGTGACCT | 235 | |
SERF_R | AACTTGCTGGTTTATCTTCACAGC | ||
HGH-F | TGCCTTCCCAACCATTCCCTTA | 434 | |
HGH-R | CCACTCACGGATTTCTGTTGTGTTTC | ||
SEQ_SERF_600_F | CTTTCTAACATATTCCCCATGCAAA | 600 | |
SEQ_SERF_600_R | TGACCAAGTGCAATACAAACCT |
PCR was performed under the following conditions. Initial denaturation was conducted at 98°C for 30 s. The PCR program began with 10 cycles of 10 s at 98°C and 60 s at 69°C followed by 20 cycles of 30 s at 98°C, 60 s at 62°C, and 30 s at 72°C. The last step was a final extension for 5 min at 72°C. The PCR products were electrophoresed at 100 volts on a 1.5% agarose gel containing 10,000X fluorescent DNA gel stain (SYBR Safe DNA Gel Stain, Invitrogen, Paisley, UK) in 1X TBE buffer. The products were visualized using a blue light transilluminator. The PCR products were subsequently purified using a gel extraction kit (GeneJET Gel Extraction Kit, Thermo Scientific, MA, USA), and the eluted fragments were sequenced (U2Bio Sequencing Service, Bangkok, Thailand) using the abovementioned PCR primers.
The
PCR was performed under the following conditions. Initial denaturation was conducted at 95°C for 30 s. The PCR program began with 10 cycles of 30 s at 95°C and 60 s at 69°C followed by 20 cycles of 10 s at 95°C, 50 s at 60°C, and 30 s at 72°C. The last step was the final extension of 5 min at 72°C before keeping the sample at 4°C. The PCR products were electrophoresed at 100 volts on a 1.5% agarose gel in 1X TBE buffer. The gel was stained with SYBR Safe Stain and visualized using a blue light transilluminator. The size of the
The known DNA controls for the
The gene and allele frequencies in the Thai blood donors were estimated using gene counting. The allele frequencies in central Thais were compared to northern and southern Thais using the Pearson’s chi-square (χ2) test. All statistical analyses were conducted using SPSS Version 16.0 (SPSS Inc., Chicago, IL, USA). A
In addition, the probability of finding one donor with a predicted SERF(-) phenotype was estimated. According to the Hardy-Weinberg Equilibrium (HWE) equation, p2+ 2pq+q2=1, where p denotes the dominant allele frequency (
The number of testing units is 1/q2.
The DNA sequencing results showed that four of the 200 Thai blood donors were heterozygous for
Total of 1,580, 300, and 427 samples were obtained from the central, northern, and southern Thai blood donors, respectively. They were genotyped for
Table 2 .
Allele | Allele frequencies | Genotype | Observed (%) | χ2 (DF=1) | |
---|---|---|---|---|---|
Central Thais (N=1,580) | |||||
3,135 (0.992) | 1,555 (98.42) | NA | NA | ||
25 (0.008) | 25 (1.58) | ||||
0 (0.00) | |||||
Northern Thais (N=300) | |||||
594 (0.990) | 294 (98.00) | 0.269 | 0.604 | ||
6 (0.010) | 6 (2.00) | ||||
0 (0.00) | |||||
Southern Thais (N=427) | |||||
848 (0.993) | 421 (98.59) | 0.069 | 0.793 | ||
6 (0.007) | 6 (1.41) | ||||
0 (0.00) |
Abbreviations: DF, degree of freedom; NA, not applicable..
According to the HWE equation, homozygous recessive individuals (
Serological methods cannot always determine rare blood phenotypes owing to the limited availability of antiserum and of unmarketed products. To date, various molecular methods for red cell genotyping can be performed in blood bank laboratories to massively screen blood donors and to distinguish antibody specificity in recently transfused patients [9-13]. Given its reliability and simplicity, PCR-SSP is widely used in genotyping SNVs, especially in laboratories with limited resources [7, 14]. In Thailand, commercial kit-based red cell genotyping involving the use of PCR-sequence-specific oligonucleotide probes like Jk(a-b-), Fy(a-b+), and Di(a+b-) is employed only in specialized reference laboratories given its high cost and the need for complex equipment. However, mass screening with the aim to identify donors carrying rare phenotypes recognizes the phenotype frequency and the phenotype’s clinical significance in hemolytic transfusion reactions and in hemolytic disease of the fetus and newborn (HDFN). Only one case of alloanti-SERF was found (a pregnant Thai woman), and the occurrence of HDFN is unlikely because the DAF on the apical surface of trophoblasts in placenta absorbs maternal antibodies [15].
Concerning the predicament in finding SERF(-) blood donors and the shortage of data in Thai populations, this study has established that PCR-SSP could determine the
The frequencies of the
In conclusion, this study was the first to distinguish the predicted SERF phenotypes from the genotyping results obtained using the in-house PCR-SSP. Moreover, the results showed that the frequency of the
Table 1 . Primer sequences for
Allele detected | Primer | Primer sequence (5’3’) | Product size (bp) |
---|---|---|---|
SERF_C+_F | TCTGTCCAGTGGAGTGACCC | 235 | |
SERF_R | AACTTGCTGGTTTATCTTCACAGC | ||
SERF_T-_F | TCTGTCCAGTGGAGTGACCT | 235 | |
SERF_R | AACTTGCTGGTTTATCTTCACAGC | ||
HGH-F | TGCCTTCCCAACCATTCCCTTA | 434 | |
HGH-R | CCACTCACGGATTTCTGTTGTGTTTC | ||
SEQ_SERF_600_F | CTTTCTAACATATTCCCCATGCAAA | 600 | |
SEQ_SERF_600_R | TGACCAAGTGCAATACAAACCT |
Table 2 .
Allele | Allele frequencies | Genotype | Observed (%) | χ2 (DF=1) | |
---|---|---|---|---|---|
Central Thais (N=1,580) | |||||
3,135 (0.992) | 1,555 (98.42) | NA | NA | ||
25 (0.008) | 25 (1.58) | ||||
0 (0.00) | |||||
Northern Thais (N=300) | |||||
594 (0.990) | 294 (98.00) | 0.269 | 0.604 | ||
6 (0.010) | 6 (2.00) | ||||
0 (0.00) | |||||
Southern Thais (N=427) | |||||
848 (0.993) | 421 (98.59) | 0.069 | 0.793 | ||
6 (0.007) | 6 (1.41) | ||||
0 (0.00) |
Abbreviations: DF, degree of freedom; NA, not applicable..